Sequence ID | >C191208176 |
Genome ID | LR134348 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium breve NCTC11815 [LR134348] |
Start position on genome | 1735963 |
End posion on genome | 1735890 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
aaacgtcgtt |
tRNA gene sequence |
GCCCGAGTAGCTCAGTGGATAGAGCACCGCTCTCCTAAAGCGGGTGTCGTCGGTTCGAAT |
Downstream region at tRNA end position |
gcgctcctga |
Secondary structure (Cloverleaf model) | >C191208176 Arg CCT t ACtt gcgctcctga G - C C - G C - G C - G G - C A - T G - C T A T T A G C C A T G A A + | | | | G G C T C G G T C G G C G | | | | T T A G A G C T A A GTGTC C - G C - G G - C C - G T - A C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |