Sequence ID | >C191208195 |
Genome ID | LR134349 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium dentium NCTC11816 [LR134349] |
Start position on genome | 502124 |
End posion on genome | 502206 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
caggcagcac |
tRNA gene sequence |
GGCGGATTTCCCAAGCGGTCAAAGGGAACTGACTGTAAATCAGTCGCCTCGTGCTTCAGT |
Downstream region at tRNA end position |
ctcgatagct |
Secondary structure (Cloverleaf model) | >C191208195 Tyr GTA c ACgc ctcgatagct G - C G - C C - G G - C G - C A - T T - A T A T T C A C C A C G A T | | | | | G G A C C C A G T G G C G | | | T T T A G G G C A A A CGCCTCGTGCTTC A - T C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |