Sequence ID | >C191211071 |
Genome ID | LR134439 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Erysipelothrix rhusiopathiae NCTC8163 [LR134439] |
Start position on genome | 636835 |
End posion on genome | 636760 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ttttgcaaat |
tRNA gene sequence |
GGTCCAGTGGTGTAGCGGTTAACATGCCTGCCTGTCACGCAGGAGATCGCGGGTTCGATT |
Downstream region at tRNA end position |
tttgcaggtg |
Secondary structure (Cloverleaf model) | >C191211071 Asp GTC t GCCA tttgcaggtg G - C G - C T - A C - G C - G A - T G - C T T T T G C C C A C G A G + | | | | G G T G T G G C G G G C G | | | + T T T A C A T T A G AGATC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |