Sequence ID | >C191212988 |
Genome ID | LR134503 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Kaistella jeonii NCTC13459 [LR134503] |
Start position on genome | 3064676 |
End posion on genome | 3064749 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aatggtgacc |
tRNA gene sequence |
GACTCGGTAGCTCAGCTGGTAGAGCAATACACTTTTAATGTATGGGTCCTGGGTTCGAAT |
Downstream region at tRNA end position |
gtaaaaaatt |
Secondary structure (Cloverleaf model) | >C191212988 Lys TTT c ACaa gtaaaaaatt G - C A - T C - G T + G C - G G - C G - C T A T G A C C C A C G A A | | | | | G T C T C G C T G G G C G | | | | T T G G A G C T A A GGGTC A - T T - A A - T C - G A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |