Sequence ID | >C191213937 |
Genome ID | LR134523 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Peptoniphilus ivorii NCTC13079 [LR134523] |
Start position on genome | 454293 |
End posion on genome | 454368 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
aattatatat |
tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGTCAGGAGTTCGAAT |
Downstream region at tRNA end position |
cacatcttcg |
Secondary structure (Cloverleaf model) | >C191213937 Ala TGC t ACCA cacatcttcg G - C G - C G + T G - C G + T T - A G - C T A T T C C T C A T G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |