Sequence ID | >C191218946 |
Genome ID | LR215967 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Chryseobacterium indologenes 3012STDY6981895 [LR215967] |
Start position on genome | 4662923 |
End posion on genome | 4662997 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ttaaaaaatt |
tRNA gene sequence |
GATCCGGTAGTTCAGCTGGTTAGAATGCCGCCCTGTCACGGCGGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
aagttttctc |
Secondary structure (Cloverleaf model) | >C191218946 Asp GTC t GCag aagttttctc G - C A - T T - A C - G C - G G - C G - C T G T T G C C C A C G A A + | | | | G T C T T G G C G G G C G | | | + T T G G A A T T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |