| Sequence ID | >C191224781 |
| Genome ID | LS991950 |
| Phylum/Class | Mycoplasmatota |
| Species | Mesomycoplasma hyorhinis NCTC10130 [LS991950] |
| Start position on genome | 295704 |
| End posion on genome | 295777 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
ttactttaat |
| tRNA gene sequence |
GGCACCATAGCCAAATGGTAAGGCATAGGTCTGCAACACCTTGATTACCGGTTCGAGTCC |
| Downstream region at tRNA end position |
tgcgcttgta |
| Secondary structure (Cloverleaf model) | >C191224781 Cys GCA
t TCCA tgcgcttgta
G - C
G - C
C - G
A - T
C - G
C - G
A - T T G
T T G G C C A
A A A | | | | | G
T A C C G A C C G G C
G | | | T T
G A G G C
T A A GATT
T T
A - T
G - C
G - C
T - A
C C
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |