Sequence ID | >WENV022221 |
Genome ID | AACY020632022 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 869 |
End posion on genome | 783 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
aaaacccttT |
tRNA gene sequence |
GCGGACGTGGCGGAATTGGTAGACGCGCACGTCTAAGGAGCGTGTGGCCTCGGCCTTGCG |
Downstream region at tRNA end position |
Aatgtattct |
Secondary structure (Cloverleaf model) | >WENV022221 Leu AAG T ATTT Aatgtattct G - C C - G G - C G - C A - T C - G G - C T G T C G C T C A T A A G | | | | | A T G G C G G C G A G C G | | | T T G A C G C T A G G TGGCCTCGGCCTT C - G A - T C - G G - C T + G C A T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |