Sequence ID | >W141551744 |
Genome ID | JHOC01000087 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli O174:H8 str. 04-3038 [JHOC] |
Start position on genome | 18724 |
End posion on genome | 18800 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
atatcacata |
tRNA gene sequence |
CCGCCATTAGCTCATCGGGATAGAGCGCCAGCCTTCGAAGCTGGCTGCGCGGGGTTCGAG |
Downstream region at tRNA end position |
ttatctgcat |
Secondary structure (Cloverleaf model) | >W141551744 Arg TCG a TCCA ttatctgcat C - G C - G G - C C - G C - G A - T T - A T G T G C T C C A C T A A | | + | | G G C T C G C G G G G C G | | | | T T G G A G C A T A G CTGCG C - G C - G A - T G - C C - G C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |