Sequence ID | >W141557273 |
Genome ID | JHVA01000001 |
Search identical group | |
Phylum/Class | Acidobacteriota |
Species | Acidobacteriaceae bacterium KBS 146 KBS 146 [JHVA] |
Start position on genome | 398269 |
End posion on genome | 398342 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gtcagtctgt |
tRNA gene sequence |
TGCCTCCTCGTTCAATGGTAGGACAGTCGGCTCTGAACCGATCAATCGGGGTTCGAATCC |
Downstream region at tRNA end position |
acaaattttt |
Secondary structure (Cloverleaf model) | >W141557273 Gln CTG t ACCA acaaattttt T - A G - C C - G C - G T - A C - G C - G T A T G T C C C A A A C | + | | | G T C T T G C G G G G C G | + | | T T G G G A C T A A CAAT G + T T - A C - G G - C G - C C A T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |