Sequence ID | >W141557390 |
Genome ID | JHVC01000018 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium lundense DSM 17049 [JHVC] |
Start position on genome | 53581 |
End posion on genome | 53506 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aatatatcga |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGTAGGTTCAAGT |
Downstream region at tRNA end position |
tgaaaatatc |
Secondary structure (Cloverleaf model) | >W141557390 Met CAT a ACCA tgaaaatatc C A G - C C - G G - C G - C G - C G - C T G T C A T C C A T G A G | | | | | A C C G A G G T A G G C G | | | | T T G G C T C C A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |