Sequence ID | >W09102724 |
Genome ID | AAIG01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Jannaschia sp. CCS1 [AAIG] |
Start position on genome | 623716 |
End posion on genome | 623792 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gaggcacggt |
tRNA gene sequence |
CGGGCTGTGGCGCAGCCTGGTAGCGCACCTGCTTCGGGAGCAGGGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
gacacatcca |
Secondary structure (Cloverleaf model) | >W09102724 Pro CGG t ACCA gacacatcca C - G G - C G - C G - C C - G T - A G - C T A T T C T C C A C G A G + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G T - A G - C C - G T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |