Sequence ID | >W141558622 |
Genome ID | JHWB01000013 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lachnobacterium bovis [JHWB] |
Start position on genome | 146055 |
End posion on genome | 146130 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
taaaaaatgT |
tRNA gene sequence |
GTGTGTGTAGCTCAGCTGGATAGAGCACTTGGCTACGGACCAAGGTGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
ttatgagacc |
Secondary structure (Cloverleaf model) | >W141558622 Arg ACG T GTac ttatgagacc G - C T - A G - C T + G G - C T - A G - C T A T T C T T C A C G A A + | + | | G T C T C G G G G A G C G | | | | T T G G A G C A T A A GTGTC C - G T - A T - A G - C G - C C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |