Sequence ID | >W141561148 |
Genome ID | JHYF01000002 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Alkaliphilus transvaalensis ATCC 700919 [JHYF] |
Start position on genome | 1044 |
End posion on genome | 1120 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tatataaaat |
tRNA gene sequence |
GGGCCTTTAGCTCAGTTGGTTAGAGCGTCCGGCTCATAACCGGTAGGTCCGGGGTTCGAG |
Downstream region at tRNA end position |
tccattttat |
Secondary structure (Cloverleaf model) | >W141561148 Met CAT t ACCA tccattttat G - C G - C G - C C - G C - G T - A T - A T G T G T C C C A T G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T T A G AGGTC T T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |