Sequence ID | >W141563983 |
Genome ID | JIAK01000001 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfovermiculus halophilus DSM 18834 [JIAK] |
Start position on genome | 26147 |
End posion on genome | 26061 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gatttcttgc |
tRNA gene sequence |
GCCGAGGTGGTGGAATCGGTAGACACGCTATCTTGAGGGGGTAGTGGGCAACAGCTCGTG |
Downstream region at tRNA end position |
tagcaaggta |
Secondary structure (Cloverleaf model) | >W141563983 Leu GAG c ACCA tagcaaggta G - C C - G C - G G - C A - T G - C G - C T A T C C C C C A T A A G | | | | | G C G G T G G G G G G C G | | | T T G A C A C T A G G TGGGCAACAGCTCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |