Sequence ID | >W09108451 |
Genome ID | ABTH01000002 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Capnocytophaga ochracea DSM 7271 [ABTH] |
Start position on genome | 3487 |
End posion on genome | 3573 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aaatgcgtaa |
tRNA gene sequence |
GCCTACGTGGAGAAATTGGTAGACTCGCCATCTTGAGGGGGTGGTGCTCGTTAGGGCGTG |
Downstream region at tRNA end position |
aaagataaga |
Secondary structure (Cloverleaf model) | >W09108451 Leu GAG a ACAA aaagataaga G - C C - G C - G T - A A - T C - G G - C T A T T G A C C A T A A G + | | | | G T A G A G G C T G G C G | | | T T G A C T C T A G G TGCTCGTTAGGGCGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |