Sequence ID | >W09113148 |
Genome ID | ABYK01000003 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Limnospira maxima CS-328 [ABYK] |
Start position on genome | 135189 |
End posion on genome | 135271 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gttgtcttcT |
tRNA gene sequence |
GCGGATGTGGCGGAATTGGTATACGCGCACGTTTGAGGGGCGTGTGGCTTTGCCTTGCGA |
Downstream region at tRNA end position |
tacttaaacc |
Secondary structure (Cloverleaf model) | >W09113148 Leu GAG T ATtt tacttaaacc G - C C - G G - C G - C A - T T - A G - C T G T C G C T C A T A A G | | | | | G T G G C G G C G A G C G | | | T T G A C G C T A T G TGGCTTTGCCTT C - G A - T C - G G - C T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |