Sequence ID | >W141621856 |
Genome ID | JJNZ01000020 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas fuliginea citrea [JJNZ] |
Start position on genome | 23582 |
End posion on genome | 23658 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tcgtcattgc |
tRNA gene sequence |
AGGGGCGTAGTTCCAATTGGTAGAACAGCGGTCTCCAAAACCGATGGTTGGGAGTTCGAG |
Downstream region at tRNA end position |
tttcttcttt |
Secondary structure (Cloverleaf model) | >W141621856 Trp CCA c GCCA tttcttcttt A - T G - C G - C G - C G - C C - G G - C T G T C T C T C A A A C A | + | | | G T C T T G G G G A G C T | | | | T T G G A A C G T A A TGGTT G A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |