Sequence ID | >W141623728 |
Genome ID | JJSV01000013 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium tuberculosis NRITLD57 [JJSV] |
Start position on genome | 17137 |
End posion on genome | 17212 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ctaccgatca |
tRNA gene sequence |
GGGGCTATGGCGCAGTTGGTAGCGCGACTCGTTCGCATCGAGTAGGTCAGGGGTTCGAAT |
Downstream region at tRNA end position |
tctaatcagt |
Secondary structure (Cloverleaf model) | >W141623728 Ala CGC a ACCA tctaatcagt G - C G - C G + T G - C C - G T - A A - T T A T T C C C C A T G A G | | | | | G T C G C G A G G G G C G | | | | T T G G C G C T A G AGGTC A - T C - G T - A C - G G - C T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |