| Sequence ID | >W09132959 |
| Genome ID | ACOO02000017 |
| Phylum/Class | Synergistota |
| Species | Jonquetella anthropi E3_33 E1 [ACOO] |
| Start position on genome | 132006 |
| End posion on genome | 131922 |
| Amino Acid | Leu |
| Anticodon | AAG |
| Upstream region at tRNA start position |
attgccgttc |
| tRNA gene sequence |
GCGGGAGTGGCGGAATTGGTAGACGCGCAAGACTAAGGATCTTGTGGGGCAACCCGTGGG |
| Downstream region at tRNA end position |
gaactttcag |
| Secondary structure (Cloverleaf model) | >W09132959 Leu AAG
c ACCA gaactttcag
G - C
C - G
G - C
G - C
G + T
A - T
G - C T T
T C C C T C A
T A A G | | | | | A
T G G C G G G G A G C
G | | | T T
G A C G C
T A G G TGGGGCAACCCGT
C - G
A - T
A - T
G - C
A - T
C A
T G
A A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |