Sequence ID | >W09119304 |
Genome ID | ACDR01000053 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Bacteroides sp. 4_3_47FAA [ACDR] |
Start position on genome | 70405 |
End posion on genome | 70481 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gcctaacatg |
tRNA gene sequence |
GTGACTATAGTTCAGTCGGTTAGAGCGTCAGATTGTGGTTCTGAATGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
tcacctatga |
Secondary structure (Cloverleaf model) | >W09119304 His GTG g CCCT tcacctatga G - C T - A G - C A - T C - G T - A A - T T A T C A C C C A T G A A | | | | | G C C T T G G T G G G C G | | + | T T G G A G C T T A G ATGTC T - A C - G A - T G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |