Sequence ID | >W141701590 |
Genome ID | JMKT01000012 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfonatronovibrio hydrogenovorans DSM 9292 [JMKT] |
Start position on genome | 115275 |
End posion on genome | 115360 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aagctgtaat |
tRNA gene sequence |
GCCGAAGTGGTGGAACTGGTAGACACGCTATCTTGAGGGGGTAGTGGGCCACGCCCGTGG |
Downstream region at tRNA end position |
caaaataatc |
Secondary structure (Cloverleaf model) | >W141701590 Leu GAG t ACCA caaaataatc G - C C - G C - G G - C A - T A - T G - C T G T C C C C C A C A A G | | | | | G T G G T G G G G G G C G | | | T T G A C A C T A G G TGGGCCACGCCCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |