Sequence ID | >W141701943 |
Genome ID | JMLD01000004 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Sphingobacterium thalpophilum DSM 11723 [JMLD] |
Start position on genome | 10 |
End posion on genome | 85 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
naaaatacat |
tRNA gene sequence |
TGCGGGGTGGAGCAGTTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCACTAGTTCGAGT |
Downstream region at tRNA end position |
aatgaaaaag |
Secondary structure (Cloverleaf model) | >W141701943 Met CAT t ACTA aatgaaaaag T T G - C C - G G - C G - C G - C G - C T G T T G G T C A T G A G | | + | | G T C G A G A C T A G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |