Sequence ID | >W141712587 |
Genome ID | JMRP01000042 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Cyanobium sp. CACIAM 14 [JMRP] |
Start position on genome | 2118 |
End posion on genome | 2045 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gtccgggccg |
tRNA gene sequence |
GGGGCTGTAGCTCAGCCGGATAGAGCGACGGTTTCCTAAACCGTAGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
cctttgcttc |
Secondary structure (Cloverleaf model) | >W141712587 Arg CCT g Gttc cctttgcttc G - C G - C G - C G - C C - G T - A G - C T G T C G C C C A C G A A | + | | | G C C T C G G T G G G C G | | | | T T G G A G C A T A G AGGTC A - T C - G G - C G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |