Sequence ID | >W141713198 |
Genome ID | JMSI01000005 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lacticaseibacillus rhamnosus 51B [JMSI] |
Start position on genome | 241801 |
End posion on genome | 241726 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
acatacttaT |
tRNA gene sequence |
TGCCCAGTAGTTCAGTGGTAGAATGCTTGACTGTTAATCAAAGGGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
ttaatcgcgg |
Secondary structure (Cloverleaf model) | >W141713198 Asn GTT T GGCC ttaatcgcgg T - A G - C C - G C - G C - G A - T G - C T A T C G A C C A G A A | | | | | G T C T T G G C T G G C G | | | + T T G G A A T T A G GGGTC C A T - A T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |