Sequence ID | >W141713216 |
Genome ID | JMSI01000013 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lacticaseibacillus rhamnosus 51B [JMSI] |
Start position on genome | 14820 |
End posion on genome | 14746 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
atcctccatT |
tRNA gene sequence |
GAGCCGTTAGCTCAGTTGGTAGAGCAACTGACTTTTAATCAGTGGGTCGACAGTTCGAGC |
Downstream region at tRNA end position |
aattattggt |
Secondary structure (Cloverleaf model) | >W141713216 Lys TTT T AGag aattattggt G - C A - T G - C C - G C - G G - C T - A C G T C T G T C A T G A A | | | | | G T C T C G G A C A G C G | | | | T T G G A G C T A A GGGTC A - T C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |