Sequence ID | >W141729057 |
Genome ID | JNHI01000019 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Phocaeicola vulgatus str. 3775 SL(B) 10 (iv) [JNHI] |
Start position on genome | 210204 |
End posion on genome | 210114 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tccgaaaaaa |
tRNA gene sequence |
GGAGAGGTGCTCGAGTGGTTGAAGAGGCACGCCTGGAAAGCGTGTATACCCCAAAAGGGT |
Downstream region at tRNA end position |
aagtagaaaa |
Secondary structure (Cloverleaf model) | >W141729057 Ser GGA a GCAA aagtagaaaa G - C G - C A - T G - C A - T G - C G + T T A T G C C C C A T G A G | | | | | G G G C T C C G G G G C G | | | T T T A G A G T G A G TATACCCCAAAAGGGTATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |