Sequence ID | >W141730031 |
Genome ID | JNIA01000015 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella wadsworthii DSM 21896 = ATCC 33877 [JNIA] |
Start position on genome | 123019 |
End posion on genome | 123092 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
atggtgtttt |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGTGGGTTCGATTCC |
Downstream region at tRNA end position |
ttaattgctt |
Secondary structure (Cloverleaf model) | >W141730031 Gly CCC t TCCA ttaattgctt G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T C T T G G T G G G C G | | | | T T G G A A C T A T TAGC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |