Sequence ID | >W141732397 |
Genome ID | JNKB01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Selenomonas bovis 8-14-1 [JNKB] |
Start position on genome | 112284 |
End posion on genome | 112368 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gacgagacat |
tRNA gene sequence |
GCGGATGTGGCGGAACTGGCAGACGCGCTGGATTTAGGATCCAGTGCCGCAAGGCGTATG |
Downstream region at tRNA end position |
gtcgaatgtg |
Secondary structure (Cloverleaf model) | >W141732397 Leu TAG t ACCA gtcgaatgtg G - C C - G G - C G - C A - T T - A G - C C C T T T C C C A C A A G | | | | G T G G C G A T G G G C G | | | T T G A C G C C A G G TGCCGCAAGGCGT C - G T - A G - C G - C A - T T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |