Sequence ID | >W141739268 |
Genome ID | JNNN01000069 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Massilia sp. LC238 [JNNN] |
Start position on genome | 26227 |
End posion on genome | 26303 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gccgtctgaa |
tRNA gene sequence |
CTGCCCATAGCTCAGTTGGATAGAGCATCAGCCTTCTAAGCTGAGGGTCGCTGGTTCGAA |
Downstream region at tRNA end position |
tcggtcgcgt |
Secondary structure (Cloverleaf model) | >W141739268 Arg TCT a GCCA tcggtcgcgt C - G T - A G - C C - G C - G C - G A - T C A T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C A T A A GGGTC T - A C - G A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |