Sequence ID | >W141754431 |
Genome ID | JNVS01000007 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas sp. KO116 [JNVS] |
Start position on genome | 18280 |
End posion on genome | 18205 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
taattacagt |
tRNA gene sequence |
GTCCCATTCGTCTAGTGGTCTAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAAC |
Downstream region at tRNA end position |
cttccgatag |
Secondary structure (Cloverleaf model) | >W141754431 Glu TTC t GCCA cttccgatag G - C T - A C - G C - G C - G A - T T - A C A T T C C C C A T G A C | | | | | G G T C T G A G G G G C G + | | | T T T G G A C C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |