Sequence ID | >W09117994 |
Genome ID | ACCN01000003 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Maridesulfovibrio salexigens DSM 2638 [ACCN] |
Start position on genome | 194980 |
End posion on genome | 194905 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caacaaatat |
tRNA gene sequence |
TCCTCGGTGGCTCAATCGGCAGAGCGGGTGACTGTTAATCACTAGGTTGGGGGTTCAAGT |
Downstream region at tRNA end position |
gatagctcaa |
Secondary structure (Cloverleaf model) | >W09117994 Asn GTT t GCCA gatagctcaa T - A C - G C - G T + G C - G G - C G - C T G T C T C C C A T A A G | + | | | A C C T C G G G G G G C G | | | | T T G G A G C C A G AGGTT G + T G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |