Sequence ID | >W141754939 |
Genome ID | JNWD01000035 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium longum subsp. longum EK13 [JNWD] |
Start position on genome | 169999 |
End posion on genome | 169925 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
atctaaccaa |
tRNA gene sequence |
GCCCCTGTAGCTCAGTTGGTTAGAGCAGCTGACTCTTAATCAGCGTGTCCAGGGTTCGAA |
Downstream region at tRNA end position |
acaaccggaa |
Secondary structure (Cloverleaf model) | >W141754939 Lys CTT a ACag acaaccggaa G - C C - G C - G C - G C - G T + G G - C T A T G T C C C A T G A A | | | | | G T C T C G C A G G G C G | | | | T T G G A G C T T A A GTGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |