Sequence ID | >W09119640 |
Genome ID | ACDZ02000003 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Gemella haemolysans ATCC 10379 [ACDZ] |
Start position on genome | 3265 |
End posion on genome | 3341 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gacttattat |
tRNA gene sequence |
TCCACAGTAGCTCAGTTGGTAGTAGCATCTGACTGTTAATCAGAGGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
ttttttggcc |
Secondary structure (Cloverleaf model) | >W09119640 Asn GTT t GCCA ttttttggcc T - A C - G C - G A - T C - G A - T G - C T G T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | T T G T A G C T A G A GGGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |