Sequence ID | >W09134812 |
Genome ID | ACVA01000031 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Prevotella veroralis F0319 [ACVA] |
Start position on genome | 59543 |
End posion on genome | 59617 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aacaagcact |
tRNA gene sequence |
GCTTCAGTAGCTCAGTTGGTTAGAGCACCTGACTGTTAATCAGGGGGTCGTTGGTTCAAG |
Downstream region at tRNA end position |
agaaaaggaa |
Secondary structure (Cloverleaf model) | >W09134812 Asn GTT t GCat agaaaaggaa G - C C - G T - A T + G C - G A - T G - C C G T C T A C C A T G A A | | | | A T C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |