Sequence ID | >W141767672 |
Genome ID | JOET01000047 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces rimosus subsp. rimosus [JOET] |
Start position on genome | 66419 |
End posion on genome | 66492 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ctcgtcgcaa |
tRNA gene sequence |
GGGCCTGTGGCGCAGCTGGTAGCGCACCTCGTTCGCAACGAGGGGGTCAGGGGTTCGAAT |
Downstream region at tRNA end position |
acatcgaagc |
Secondary structure (Cloverleaf model) | >W141767672 Ala CGC a ACag acatcgaagc G - C G - C G + T C - G C - G T - A G - C T A T T C C C C A C G A G | | | | | G T C G C G A G G G G C G | | | | T T G G C G C T A A GGGTC C - G C - G T - A C - G G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |