Sequence ID | >W141770096 |
Genome ID | JOGG01000024 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces sp. NRRL B-5680 [JOGG] |
Start position on genome | 141662 |
End posion on genome | 141589 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tgtgttgcct |
tRNA gene sequence |
GGTGGAGTGGCCGAGAGGCGAGGCAACGGCCTGCAAAGCCGTGTACACGGGTTCAAATCC |
Downstream region at tRNA end position |
agaggctctc |
Secondary structure (Cloverleaf model) | >W141770096 Cys GCA t TCCA agaggctctc G - C G - C T - A G - C G - C A - T G - C T A T T G C C C A G A G | | | | | A A G C C G A C G G G C G | | | T T G A G G C C G A GTAC A - T C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |