Sequence ID | >W141775993 |
Genome ID | JOKH01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Endozoicomonas numazuensis [JOKH] |
Start position on genome | 1678133 |
End posion on genome | 1678209 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
attggaaata |
tRNA gene sequence |
CGGCGTGTAGCGCAGCCTGGTAGCGCATTTCGTTCGGGACGAAAGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
gtaggagcct |
Secondary structure (Cloverleaf model) | >W141775993 Pro CGG a ACCA gtaggagcct C - G G - C G - C C - G G - C T - A G - C T A T T C T C C A C G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC T - A T - A T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |