Sequence ID | >W141776970 |
Genome ID | JOML01000002 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Hydrogenovibrio marinus DSM 11271 [JOML] |
Start position on genome | 451247 |
End posion on genome | 451337 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cacctgttcc |
tRNA gene sequence |
GGTGGACTGGCTGAGTGGTTGAAGGCGGCGGTCTTGAAAACCGTTGTAGGTTAGTAGCCT |
Downstream region at tRNA end position |
tttttcaatg |
Secondary structure (Cloverleaf model) | >W141776970 Ser TGA c GCCA tttttcaatg G - C G - C T - A G - C G - C A - T C - G T A T A T C C C A T G A G | + | | | G G G T C G T G G G G C G + | | T T T A G G C T G A G TGTAGGTTAGTAGCCTACC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |