Sequence ID | >W141778834 |
Genome ID | JONI01000004 |
Search identical group | |
Phylum/Class | Thermotogota |
Species | Pseudothermotoga hypogea DSM 11164 [JONI] |
Start position on genome | 256450 |
End posion on genome | 256525 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccttggttga |
tRNA gene sequence |
GCCCCCATCGTCTAGCGGCCTAGGACACTGGCCTTTCAAGCCAGAAGCAGGGGTTCGAAT |
Downstream region at tRNA end position |
gagtgttcta |
Secondary structure (Cloverleaf model) | >W141778834 Glu TTC a GCCA gagtgttcta G - C C - G C - G C - G C - G C - G A - T T A T T C C C C A C G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A A AAGC C - G T - A G - C G - C C - G C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |