Sequence ID | >W09105986 |
Genome ID | AASK01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Maricaulis maris MCS10 [AASK] |
Start position on genome | 723398 |
End posion on genome | 723473 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
acattggttc |
tRNA gene sequence |
GGGGCCGTAGCTCAGTTGGGAGAGCGCGTCGTTCGCAATGACGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
ttctcgtgaa |
Secondary structure (Cloverleaf model) | >W09105986 Ala CGC c ACCA ttctcgtgaa G - C G - C G + T G - C C - G C - G G - C C T T T C G C C A T G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A G AGGTC C - G G - C T - A C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |