Sequence ID | >W141801494 |
Genome ID | JPEE01000013 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Peptococcaceae bacterium SCADC1_2_3 [JPEE] |
Start position on genome | 5320 |
End posion on genome | 5394 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cgtggcacca |
tRNA gene sequence |
GCGGGAGTAGCTCAGCGGTAGAGCATCGCCTTGCCAAGGCGAGGGTCGCGGGTTCGAATC |
Downstream region at tRNA end position |
gttatattat |
Secondary structure (Cloverleaf model) | >W141801494 Gly GCC a TCCA gttatattat G - C C - G G - C G - C G - C A - T G - C T A T T G C C C A G A A + | | | | G C C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |