Sequence ID | >W09113850 |
Genome ID | ABZA01000001 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Culex quinquefasciatus of Culex quinquefasciatus JHB [ABZA] |
Start position on genome | 294477 |
End posion on genome | 294402 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
agcaagaatt |
tRNA gene sequence |
GGGGGCATAGCTCAGCTGGTAGAGCATCTGTTTTGCACGCAGAAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
atataggttc |
Secondary structure (Cloverleaf model) | >W09113850 Ala TGC t ACCA atataggttc G - C G - C G + T G - C G - C C - G A - T C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A A AGGTC T - A C - G T - A G - C T + G T C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |