Sequence ID | >W141804596 |
Genome ID | JPIK01000020 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfonatronum thiodismutans [JPIK] |
Start position on genome | 5448 |
End posion on genome | 5524 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tcctcgcttt |
tRNA gene sequence |
GCGCCAGTAGCTCAGTTGGATAGAGCATCGGCCTTCTAAGCCGAGGGTCGGGGGTTCGAT |
Downstream region at tRNA end position |
aaaaattaag |
Secondary structure (Cloverleaf model) | >W141804596 Arg TCT t GCCA aaaaattaag G - C C - G G - C C - G C - G A - T G - C C T T C C T C C A T G A A | | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GGGTC T - A C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |