Sequence ID | >W141805069 |
Genome ID | JPJA01000089 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio sp. ER1A [JPJA] |
Start position on genome | 13502 |
End posion on genome | 13577 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aaaatttgtg |
tRNA gene sequence |
GTGGCTATAGCTCAGTTGGTAGAGCCCTGGATTGTGATTCCGGTGGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
tttattttgg |
Secondary structure (Cloverleaf model) | >W141805069 His GTG g CCCA tttattttgg G - C T - A G - C G - C C - G T - A A - T T A T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A C TGGTC C - G T + G G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |