Sequence ID | >W141809031 |
Genome ID | JPRE01000005 |
Search identical group | |
Phylum/Class | Chloroflexota |
Species | Dehalococcoides mccartyi [JPRE] |
Start position on genome | 396381 |
End posion on genome | 396456 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
aaagcggcct |
tRNA gene sequence |
GCGCCTATAGCTCAGTGGATAGAGCATCGGTCTTCGGAACCGAGGGTCGTGGGTTCGAAT |
Downstream region at tRNA end position |
aaattaaagc |
Secondary structure (Cloverleaf model) | >W141809031 Arg TCG t GCCA aaattaaagc G - C C - G G - C C - G C - G T - A A - T T A T C T C C C A T G A A | | | | G G C T C G G T G G G C G | | | | T T A G A G C T A A GGGTC T - A C - G G - C G - C T - A C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |