| Sequence ID | >W141809052 |
| Genome ID | JPRE01000005 |
| Phylum/Class | Chloroflexota |
| Species | Dehalococcoides mccartyi [JPRE] |
| Start position on genome | 545110 |
| End posion on genome | 545034 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
cttgcacagt |
| tRNA gene sequence |
CGGGGTGTAGCGCAGCCTGGTAGCGCACCTGAATGGGGTTCAGGTGGTCGGAGGTTCAAA |
| Downstream region at tRNA end position |
ttttctctaa |
| Secondary structure (Cloverleaf model) | >W141809052 Pro GGG
t ACCA ttttctctaa
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T T C T C C A
C G A A + | | | | A
C C G C G G G A G G C
T | | | | T T
G G C G C
G T A A TGGTC
C - G
C - G
T - A
G - C
A - T
A T
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |