Sequence ID | >W141809316 |
Genome ID | JPRJ01000048 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Chryseobacterium piperi [JPRJ] |
Start position on genome | 9711 |
End posion on genome | 9787 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tttttaaatt |
tRNA gene sequence |
GCCTCCATAGCTCAGTTGGCCAGAGCACGTGATTTGTAATCTCGGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
tttaatataa |
Secondary structure (Cloverleaf model) | >W141809316 Thr TGT t TCAA tttaatataa G - C C - G C - G T - A C - G C - G A - T T A T C T C C C A T G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C C C A A GGGTC C - G G - C T T G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |