Sequence ID | >W141812222 |
Genome ID | JPZT01000005 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Altibacter lentus [JPZT] |
Start position on genome | 19549 |
End posion on genome | 19475 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gaaaataaat |
tRNA gene sequence |
GGTCCGTTCGTCTAGGGGTTAGGACGCCAGGTTTTCATCCTGGTAACAGGGGTTCGATTC |
Downstream region at tRNA end position |
agaattaagt |
Secondary structure (Cloverleaf model) | >W141812222 Glu TTC t ACAA agaattaagt G + T G - C T - A C - G C - G G - C T - A T T T T C C C C A G G A C | | | | | G G T C T G A G G G G C G + | | | T T T G G A C T A G TAAC C - G C - G A - T G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |