Sequence ID | >W141812380 |
Genome ID | JQDQ01000092 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Smithella sp. SCADC [JQDQ] |
Start position on genome | 188 |
End posion on genome | 114 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttaatcaagc |
tRNA gene sequence |
GGGCTGTTAGCTCAGCGGTAGAGCAGTGGACTTTTAATCCATTGGCCGGGGGTTCAAATC |
Downstream region at tRNA end position |
tttttaaaag |
Secondary structure (Cloverleaf model) | >W141812380 Lys TTT c ACCA tttttaaaag G - C G - C G - C C - G T + G G - C T - A T A T C C C C C A G A A | | | | | A C C T C G G G G G G C G | | | | T T G G A G C T A A TGGCC G + T T - A G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |